View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571_high_28 (Length: 307)
Name: NF1571_high_28
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1571_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 5e-50; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 190 - 290
Target Start/End: Complemental strand, 42028178 - 42028078
Alignment:
| Q |
190 |
cgcagccagaacacgttcagtcacctcagcacacttgttgatgtcatgagatccatccactaggatttcgggctccactataggaactaggccattctct |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42028178 |
cgcagccagaacacgttcagtcacctcagcacacttgttgatgtcatgagatccatccactaggatttcgggctccactataggaactaggccattctct |
42028079 |
T |
 |
| Q |
290 |
t |
290 |
Q |
| |
|
| |
|
|
| T |
42028078 |
t |
42028078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 80 - 290
Target Start/End: Original strand, 26629676 - 26629886
Alignment:
| Q |
80 |
gctataacttcaggggcaactttttgagaatctaaaccgggggttaccatgttaggcttcaaaagagttccttcgagcagaacatgatgatcacttaaag |
179 |
Q |
| |
|
|||||||| ||||| |||||||| |||||||| | || || || ||||| ||||||||||||||||| ||||| || ||||||||||| ||||||| || |
|
|
| T |
26629676 |
gctataacctcaggagcaactttaggagaatctgatcctggtgtaaccatattaggcttcaaaagagtaccttcaagaagaacatgatggtcacttagag |
26629775 |
T |
 |
| Q |
180 |
ctttgtagcacgcagccagaacacgttcagtcacctcagcacacttgttgatgtcatgagatccatccactaggatttcgggctccactataggaactag |
279 |
Q |
| |
|
| ||||| || || || ||||| ||||| || || ||||| ||||| ||||| || | |||||||||||| || || |||||||| || ||||| | |
|
|
| T |
26629776 |
ccttgtaacatgctgcaagaacgcgttctgttacatcagcgcactttgcaatgtcgtggggtccatccactagaatctcaggctccacaattggaaccaa |
26629875 |
T |
 |
| Q |
280 |
gccattctctt |
290 |
Q |
| |
|
|||||||||| |
|
|
| T |
26629876 |
accattctctt |
26629886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University