View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571_high_30 (Length: 298)
Name: NF1571_high_30
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1571_high_30 |
![](./plan/images/spacer.gif) | ![NF1571_high_30](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 11 - 281
Target Start/End: Original strand, 43476467 - 43476736
Alignment:
Q |
11 |
caaaggggaaaaatgtctttctaaataaaccagcgaagatgttcgtcaatagtattctcctaatatagacccctttttaaatgataatcttccgagaaaa |
110 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
43476467 |
caaaggggaaaaatgtctttctaaataa-ccagcgaagatgtccgtcaatagtattctcctaatatagacacctttttaaatgataatcttccgagaaaa |
43476565 |
T |
![](./plan/images/spacer.gif) |
Q |
111 |
gtttatatggtaccaacaccaaagtttcctcataataaaggggaagtgtgtaagttgaagaaagccttccatagtctgaaacaagtacatgagcttggtt |
210 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43476566 |
gtttatatggtacctccaccaaagtttcctcataataaaggggaagtgtgtaagttgaagaaagccttccatagtctgaaacaagtacatgagcttggtt |
43476665 |
T |
![](./plan/images/spacer.gif) |
Q |
211 |
tgagaagttcttcaccgtcatttcatttatcgatttttgttctagtgatcatgattttgctttgtttctta |
281 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43476666 |
tgagaagttcttcaccgtcatttcatttatcgatttttgttctagtgatcatgattttgctttgtttctta |
43476736 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 219
Target Start/End: Complemental strand, 9878494 - 9878413
Alignment:
Q |
139 |
ctcataataaaggggaagtgtgtaagttgaagaaagccttccatagtctgaaacaag-tacatgagcttggtttgagaagtt |
219 |
Q |
|
|
|||||||| ||||||||||||||||||| ||||| | || | ||||||||||||| | | ||||||||||||||||||| |
|
|
T |
9878494 |
ctcataatcaaggggaagtgtgtaagttaaagaaggttttatacagtctgaaacaagctccgcgagcttggtttgagaagtt |
9878413 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 21946 times since January 2019
Visitors: 1208