View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571_low_19 (Length: 404)
Name: NF1571_low_19
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1571_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 20 - 395
Target Start/End: Original strand, 25296764 - 25297143
Alignment:
| Q |
20 |
tcctatcaagtaaatttgagctcatttatgtcaagctt-atttgtatatcaaataaattggacaaataggggtaaatagtttttgtctttttaaaactat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25296764 |
tcctatcaagtaaatttgagctcatttatgtcaagctttatttgtatatcaaataaattggaccaatagggctaaatagtttttgtctttttaaaactat |
25296863 |
T |
 |
| Q |
119 |
ttgtatattctatggtcaaattgaagtactctattttatcattttatgtaatttttaaattcagttaggtgtctttgttcgtttagaggttactttggaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| || ||||||||||||||||||||||||||||||||| || |
|
|
| T |
25296864 |
ttgtatattctatggtcaaattgaagtactctattttatcatctcatgtaatttttaaatccatttaggtgtctttgttcgtttagaggttactttgcaa |
25296963 |
T |
 |
| Q |
219 |
taggttacctacaaaggataattaatttaaaagaggtattagtccacaaaattctcagttatgtat---tggtggttgcggcaatttggaaacaacaaat |
315 |
Q |
| |
|
||| ||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
25296964 |
tagtttacctataaaggataattaatgtaaaaaaggtattagtccacaaaattctcagttatgtattaatggtggttgccgcaatttggaaacaacaaat |
25297063 |
T |
 |
| Q |
316 |
cacctcnnnnnnnaattgtaatatttttggttcgttatggcatcatgtgcttaattggttaggcttcttttcggttcatc |
395 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25297064 |
cacctttttttttaattgtaatatttttggttccttatggcatcatgtgcttaattagttaggcttcttttcggttcatc |
25297143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University