View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1571_low_30 (Length: 307)

Name: NF1571_low_30
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1571_low_30
NF1571_low_30
[»] chr7 (1 HSPs)
chr7 (190-290)||(42028078-42028178)
[»] chr1 (1 HSPs)
chr1 (80-290)||(26629676-26629886)


Alignment Details
Target: chr7 (Bit Score: 101; Significance: 5e-50; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 190 - 290
Target Start/End: Complemental strand, 42028178 - 42028078
Alignment:
190 cgcagccagaacacgttcagtcacctcagcacacttgttgatgtcatgagatccatccactaggatttcgggctccactataggaactaggccattctct 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42028178 cgcagccagaacacgttcagtcacctcagcacacttgttgatgtcatgagatccatccactaggatttcgggctccactataggaactaggccattctct 42028079  T
290 t 290  Q
    |    
42028078 t 42028078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 80 - 290
Target Start/End: Original strand, 26629676 - 26629886
Alignment:
80 gctataacttcaggggcaactttttgagaatctaaaccgggggttaccatgttaggcttcaaaagagttccttcgagcagaacatgatgatcacttaaag 179  Q
    |||||||| ||||| ||||||||  |||||||| | || || || ||||| ||||||||||||||||| ||||| || ||||||||||| ||||||| ||    
26629676 gctataacctcaggagcaactttaggagaatctgatcctggtgtaaccatattaggcttcaaaagagtaccttcaagaagaacatgatggtcacttagag 26629775  T
180 ctttgtagcacgcagccagaacacgttcagtcacctcagcacacttgttgatgtcatgagatccatccactaggatttcgggctccactataggaactag 279  Q
    | ||||| || || || ||||| ||||| || || ||||| |||||    ||||| || | |||||||||||| || || |||||||| || ||||| |     
26629776 ccttgtaacatgctgcaagaacgcgttctgttacatcagcgcactttgcaatgtcgtggggtccatccactagaatctcaggctccacaattggaaccaa 26629875  T
280 gccattctctt 290  Q
     ||||||||||    
26629876 accattctctt 26629886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University