View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571_low_41 (Length: 254)
Name: NF1571_low_41
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1571_low_41 |
![](./plan/images/spacer.gif) | ![NF1571_low_41](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 4 - 242
Target Start/End: Original strand, 7726510 - 7726748
Alignment:
Q |
4 |
ggtggaaagtcaatggttttggtgaataaaaatgttgcatgtcttggatttgtggatggtggtgaagagtcaagaacagctgttgttattggtggacacc |
103 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
T |
7726510 |
ggtggaaattcaatggttttggtgaataaaaatgttgcatgtcttggatttgtggatggtggtaaagagccaagaacagctgttgttattggtggacacc |
7726609 |
T |
![](./plan/images/spacer.gif) |
Q |
104 |
agttggaggacattgtgttggagtttgatttggtttcttctaaattaggattcagctcttccctccgccttcaaaatgcaagttgttccaactccaactc |
203 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
7726610 |
agttggaggacattgtattggagtttgatttggtttcttctaaattaggattcagctcttccctcctccttcaaaatgcaagttgttccaactccaactc |
7726709 |
T |
![](./plan/images/spacer.gif) |
Q |
204 |
agtgaataagatggtaaaatctggtgaaagtttcatttc |
242 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7726710 |
agtgaataagatggtaaaatctggtgaaagtttcatttc |
7726748 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 7733929 - 7734170
Alignment:
Q |
1 |
tttggtggaaagtcaatggttttggtgaataaaaatgttgcatgtcttggatttgtggatggtggtgaagagtcaagaacagctgttgttattggtggac |
100 |
Q |
|
|
||||||||||| || ||||| ||||||| ||||||||| ||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
T |
7733929 |
tttggtggaaattctatggtcttggtgagtaaaaatgtagcatgtcttggatttgtggatggtggtaaagagccaagaacagctgttgttattggtggac |
7734028 |
T |
![](./plan/images/spacer.gif) |
Q |
101 |
accagttggaggacattgtgttggagtttgatttggtttcttctaaattaggattcagctcttccctccgccttcaaaatgcaagttgttccaactccaa |
200 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||| |
|
|
T |
7734029 |
accagttggaggacattgtattggagtttgatttggtttcttctaaattaggattcagctcttccttgctccttcaaaatgcaagttgttccaactccaa |
7734128 |
T |
![](./plan/images/spacer.gif) |
Q |
201 |
ctcagtgaataagatggtaaaatctggtgaaagtttcatttc |
242 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
7734129 |
ttcagtgaataagatggtaaaatctagtgaaagtttcatttc |
7734170 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 7711619 - 7711811
Alignment:
Q |
1 |
tttggtggaaagtcaatggttttggtgaataaaaatgttgcatgtcttggatttgtggatggtggtgaagagtcaagaacagctgttgttattggtggac |
100 |
Q |
|
|
||||||||||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |||||||||| |
|
|
T |
7711619 |
tttggtggaaattcaatggtgttggtgagtaaaaatgttgcatgtcttggatttgtggatggtggtaaagagccaagaacagctgttgtgattggtggac |
7711718 |
T |
![](./plan/images/spacer.gif) |
Q |
101 |
accagttggaggacattgtgttggagtttgatttggtttcttctaaattaggattcagctcttccctccgccttcaaaatgcaagttgttcca |
193 |
Q |
|
|
|||| |||||||||| | | ||||||||||||||| ||||||||||||||||||||||||||||| | | ||||||||||| ||||||||||| |
|
|
T |
7711719 |
accaattggaggacaatctattggagtttgatttgatttcttctaaattaggattcagctcttccttgctccttcaaaatggaagttgttcca |
7711811 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 7745973 - 7745818
Alignment:
Q |
1 |
tttggtggaaagtcaatggttttggtgaataaaaatgttgcatgtcttggatttgtggatggtggtgaagagtcaagaacagctgttgttattggtggac |
100 |
Q |
|
|
||||||||||| || |||| ||||||| ||||||||| ||||||||||||||||||||||||||| | ||| ||||||| |||||||| |||||||||| |
|
|
T |
7745973 |
tttggtggaaattctatggccttggtgagtaaaaatgtagcatgtcttggatttgtggatggtggtaatgagccaagaactgctgttgtgattggtggac |
7745874 |
T |
![](./plan/images/spacer.gif) |
Q |
101 |
accagttggaggacattgtgttggagtttgatttggtttcttctaaattaggattc |
156 |
Q |
|
|
|||| |||||||||| | | |||||||||||||||||||||||||||||||||||| |
|
|
T |
7745873 |
accaattggaggacaatctattggagtttgatttggtttcttctaaattaggattc |
7745818 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 3 - 196
Target Start/End: Original strand, 7704299 - 7704492
Alignment:
Q |
3 |
tggtggaaagtcaatggttttggtgaataaaaatgttgcatgtcttggatttgtggatggtggtgaagagtcaagaacagctgttgttattggtggacac |
102 |
Q |
|
|
||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |||| |||||| | | ||||||||||||| ||| |
|
|
T |
7704299 |
tggtggaaattcaatggtgttggtgaataaaaatgtagcatgtcttggatttgtggatggtggtaaagaaccaagaagatcaattgttattggtgggcac |
7704398 |
T |
![](./plan/images/spacer.gif) |
Q |
103 |
cagttggaggacattgtgttggagtttgatttggtttcttctaaattaggattcagctcttccctccgccttcaaaatgcaagttgttccaact |
196 |
Q |
|
|
|| |||||||| | | | |||||||||||||| |||||||| ||||||||||||| ||||||||| | |||||| ||| |||| | |||||||| |
|
|
T |
7704399 |
caattggaggagaatctattggagtttgatttagtttcttccaaattaggattcatctcttcccttccccttcataattcaagatattccaact |
7704492 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 4 - 191
Target Start/End: Original strand, 7699599 - 7699786
Alignment:
Q |
4 |
ggtggaaagtcaatggttttggtgaataaaaatgttgcatgtcttggatttgtggatggtggtgaagagtcaagaacagctgttgttattggtggacacc |
103 |
Q |
|
|
|||||||| |||||||| |||||||||||||| || ||| ||||||||||||||||||||||| || || ||| |||| | |||||||||||||| |||| |
|
|
T |
7699599 |
ggtggaaattcaatggtgttggtgaataaaaaggtagcaagtcttggatttgtggatggtggtaaaaagccaacaacatcagttgttattggtgggcacc |
7699698 |
T |
![](./plan/images/spacer.gif) |
Q |
104 |
agttggaggacattgtgttggagtttgatttggtttcttctaaattaggattcagctcttccctccgccttcaaaatgcaagttgttc |
191 |
Q |
|
|
| |||||||||| | | ||||||||||||| ||||| |||||||||||||||||||||||||| | ||||| |||||||| ||||| |
|
|
T |
7699699 |
aattggaggacaatctactggagtttgatttagtttcatctaaattaggattcagctcttccctgcttcttcataatgcaagatgttc |
7699786 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7135 times since January 2019
Visitors: 1243