View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571_low_47 (Length: 246)
Name: NF1571_low_47
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1571_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 23310755 - 23310871
Alignment:
| Q |
1 |
tatcccttcctttttcaattcttggactatttatttacaattttttatcacagcaacttttcagatctttctttacaatatatcaaacgaaaattgaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23310755 |
tatcccttcctttttcaattcttggactatttatttacaattttttatcacagcaacttttcagatctttctttacaatatatcaaacgaaaattgaaga |
23310854 |
T |
 |
| Q |
101 |
tttttcagagttcattt |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
23310855 |
tttttcagagttcattt |
23310871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 193 - 229
Target Start/End: Original strand, 23310947 - 23310983
Alignment:
| Q |
193 |
tattgtcttactgggagaacactagagactacgaagc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23310947 |
tattgtcttactgggagaacactagagactacgaagc |
23310983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 97; Significance: 9e-48; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 34239372 - 34239264
Alignment:
| Q |
1 |
tatcccttcctttttcaattcttggactatttatttacaattttttatcacagcaacttttcagatctttctttacaatatatcaaacgaaaattgaaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
34239372 |
tatcccttcctttttcaattcttggactatttatttacacttttttatcacagcaacttttcagatctttctttacagtatatcaaaagaaaattgaaga |
34239273 |
T |
 |
| Q |
101 |
tttttcaga |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
34239272 |
tttttcaga |
34239264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 41527280 - 41527325
Alignment:
| Q |
1 |
tatcccttcctttttcaattcttggactatttatttacaatttttt |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
41527280 |
tatcccttcctttttcaattcttggactatttacttacactttttt |
41527325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 68 - 109
Target Start/End: Original strand, 41527323 - 41527364
Alignment:
| Q |
68 |
tttctttacaatatatcaaacgaaaattgaagatttttcaga |
109 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41527323 |
tttctctacagtatatcaaacgaaaattgaagatttttcaga |
41527364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 8469500 - 8469562
Alignment:
| Q |
1 |
tatcccttcctttttcaattcttggactatttatttacaattttttatcacagcaacttttca |
63 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
8469500 |
tatcccttcctttttcaattattggactatttatttacacttttttatcacaacaacttttca |
8469562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University