View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571_low_56 (Length: 233)
Name: NF1571_low_56
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1571_low_56 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 49019692 - 49019909
Alignment:
Q |
1 |
cttcaacctcaacatttcaatcaaatattactctcaactcctctgtttttctctgtttcatccaacttattcattaccctctacaccccaaatggctgta |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49019692 |
cttcaacctcaacatttcaatcaaatattactctcaactcctctgtttttctctgtttcatccaacttattcattaccctctacaccccaaatggctgta |
49019791 |
T |
|
Q |
101 |
tctggctttgaaggatttgagaaacggttggaacttcatttctttggagatgatccaattaccttccaactaggtctaagaaaaattgattttgaatcaa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49019792 |
tctggctttgaaggatttgagaaacggttggaacttcatttctttggagatgatccaattaccttccaactaggtctaagaaaaattgattttgaatcaa |
49019891 |
T |
|
Q |
201 |
tacaacaagtgttagaag |
218 |
Q |
|
|
|||||||||| ||||||| |
|
|
T |
49019892 |
tacaacaagttttagaag |
49019909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 101 - 158
Target Start/End: Complemental strand, 7082019 - 7081962
Alignment:
Q |
101 |
tctggctttgaaggatttgagaaacggttggaacttcatttctttggagatgatccaa |
158 |
Q |
|
|
||||| |||||||| ||||| ||| | || ||||||||||||||||| |||||||||| |
|
|
T |
7082019 |
tctggttttgaaggctttgaaaaaagattagaacttcatttctttggtgatgatccaa |
7081962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10498 times since January 2019
Visitors: 6101