View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1572-INSERTION-6 (Length: 410)
Name: NF1572-INSERTION-6
Description: NF1572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1572-INSERTION-6 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 257; Significance: 1e-143; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 115 - 410
Target Start/End: Complemental strand, 34660056 - 34659768
Alignment:
| Q |
115 |
gagtaataatcttttatatatctaatctaatctaatctggaaaacactggaaaagtacattagttatgttttagattggtgccttttcttttgggtacaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34660056 |
gagtaataatcttttatatatctaatctaatct-----ggaaaacactggaaaagtactttagttatgttttagattggtgccttttcttttgggtacaa |
34659962 |
T |
|
| Q |
215 |
attagtgctttattcccacaaattatgattttttatggttgttgctaagttttgtgtatggattgccttattccctcgccctttcctttatgttataatc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34659961 |
attagtgctttattcccacaaattatgattttttatggttgttgctaagttttgtgtatggattgccttattccctcgccctttcctttatgttataatc |
34659862 |
T |
|
| Q |
315 |
atcatatacaatacccccaaactaaggaattcttaggtttagtaatattgtttttcaaagaaaaattatgaccgtattccctcccttttctttgtg |
410 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34659861 |
atc--atacaatacccccaaactaaggaattcttaggtttagtaatattgtttttcaaagaaaaattatgaccctattccctcccttttctttgtg |
34659768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 10 - 49
Target Start/End: Complemental strand, 34660161 - 34660122
Alignment:
| Q |
10 |
aaattgaaatccgagaatgaacgacgggttctaataggag |
49 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
34660161 |
aaattgaaatctgagaatgaacgatgggttctaataggag |
34660122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 333 - 410
Target Start/End: Complemental strand, 34668635 - 34668559
Alignment:
| Q |
333 |
aaactaaggaattcttaggtttagtaatattgtttttcaaagaaaaattatgaccgtattccc-tcccttttctttgtg |
410 |
Q |
| |
|
||||||||||| ||||||||||||||||| || ||| |||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
34668635 |
aaactaaggaactcttaggtttagtaatactg--cttctgagaaaaattatggtcgtattcccttcccttttctttgtg |
34668559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University