View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15720_high_29 (Length: 258)
Name: NF15720_high_29
Description: NF15720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15720_high_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 17995032 - 17995253
Alignment:
| Q |
1 |
tgtaaaatgtgaaatatttgaatatatttccatatacatgattggtttgcaaatttatttgttgtattatccaacatgatgctccttttgttgttaacta |
100 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17995032 |
tgtaaaatgttaaatattttaatatatttccatatacatgcttggtttgcaaacttatttgttgtattatccaac------ctccttttgttgttaacta |
17995125 |
T |
 |
| Q |
101 |
gtaattataacaatggttcttctctttttaaggttttagaaaatatccaacatcattcttatgcttcctcgcaacactctcacacacctttatcctggcc |
200 |
Q |
| |
|
||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17995126 |
gtaatca---caatggttcttctctttttaaggttttagaaaatatccaacatcattcttattcttcctcgcaacactctcacacaccttta-------- |
17995214 |
T |
 |
| Q |
201 |
ttccttagcaactgtaccccactagcttcaaatcgatatg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17995215 |
-tccttagcaactgtaccccactagcttcaaatcgatatg |
17995253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 17994951 - 17995031
Alignment:
| Q |
1 |
tgtaaaatgtgaaatatttgaatatatttccatatacatgattggtttgcaaatttatttgttgtattatccaacatgatg |
81 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17994951 |
tgtaaaatgttaaatattttaatatatttccatatacatgcttggtttgcaaacttatttgttgtattatccaacatgatg |
17995031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 17999395 - 17999475
Alignment:
| Q |
1 |
tgtaaaatgtgaaatatttgaatatatttccatatacatgattggtttgcaaatttatttgttgtattatccaacatgatg |
81 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| || ||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
17999395 |
tgtaaaatgttaaatatttgaatatatttccatatacatgcttcgtttgcaaacttatttggtgtattatccaacatgatg |
17999475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 151 - 240
Target Start/End: Original strand, 17999697 - 17999777
Alignment:
| Q |
151 |
catcattcttatgcttcctcgcaacactctcacacacctttatcctggccttccttagcaactgtaccccactagcttcaaatcgatatg |
240 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17999697 |
catcattcttattcttcctcgcaacactctcacacaccttta---------tccttagcaactgtgccccactagcttcaaatcgatatg |
17999777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 17999476 - 17999533
Alignment:
| Q |
1 |
tgtaaaatgtgaaatatttgaatatatttccatatacatgattggtttgcaaatttat |
58 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||| |||||||||||| |||| |
|
|
| T |
17999476 |
tgtaaaatgttaaatatttgaatatgtttccatatacatgcttggtttgcaaacttat |
17999533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 81
Target Start/End: Original strand, 17999355 - 17999394
Alignment:
| Q |
42 |
ttggtttgcaaatttatttgttgtattatccaacatgatg |
81 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17999355 |
ttggtttgcaaacttatttgttgtattatccaacatgatg |
17999394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University