View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15720_low_39 (Length: 250)
Name: NF15720_low_39
Description: NF15720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15720_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 52851018 - 52851256
Alignment:
| Q |
1 |
taagagcataaaatcccttagttggaaggacacaatgtctaccctttaatagagctagcttgaggggggaaaaaggggacatttcagcaattcaaactca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| ||| |
|
|
| T |
52851018 |
taagagcataaaatcccttagttggaaggacacaatgtctaccctttaatagagctagcttgagggg-gaaaaaggggacatttcagcaatttaaattca |
52851116 |
T |
 |
| Q |
101 |
ggtcggttaaattagtgttgcagtttacttctacttttatcttctaggtttcgttctatcattgnnnnnnnntgtaagatgatagtgattaaattaaagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52851117 |
ggtcggttaaattagtgttgcagtttacttctacttttatcttctaggtttcgttctatcattgaaaagaaatgtaagatgatagtgattaaattaaagt |
52851216 |
T |
 |
| Q |
201 |
aaatgcttcctacctatattcatcttcatcatctattcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52851217 |
aaatgcttcctacctatattcatcttcatcatctattcat |
52851256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University