View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15720_low_43 (Length: 242)
Name: NF15720_low_43
Description: NF15720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15720_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 7e-73; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 50 - 224
Target Start/End: Original strand, 50070248 - 50070422
Alignment:
| Q |
50 |
gacacaaaaacaactagcaagcacggtcatatttagtgatgatagtagctagacttggtaaattggaggatggattagttgtaattaggattggccaaaa |
149 |
Q |
| |
|
|||||||| | |||||||||| || |||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50070248 |
gacacaaagaaaactagcaagaacactcatgttcactgatgatagtagctagacttggtaaattggaggatggattagttgtaattaggattggccaaaa |
50070347 |
T |
|
| Q |
150 |
cataaccctcaatggccttgaaaagagcatcacccttggctttgccttcctcaacctccttttcaattggcttag |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50070348 |
cataaccctcaatggccttgaaaagagcatcccccttggctttgccttcctcaacctccttttcaattggcttag |
50070422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 102 - 224
Target Start/End: Original strand, 50078703 - 50078825
Alignment:
| Q |
102 |
acttggtaaattggaggatggattagttgtaattaggattggccaaaacataaccctcaatggccttgaaaagagcatcacccttggctttgccttcctc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50078703 |
acttggtaaattggaggatggattagttgtaattaggattggccaaaacataaccctcaatggccttgaaaagagcatcccccttggctttgccttcctc |
50078802 |
T |
|
| Q |
202 |
aacctccttttcaattggcttag |
224 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
50078803 |
aacctccttttcaattggcttag |
50078825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 16 - 73
Target Start/End: Original strand, 50078647 - 50078704
Alignment:
| Q |
16 |
aagaaaaaactttattacattggaagattaagaagacacaaaaacaactagcaagcac |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50078647 |
aagaaaaaactttattacattggaagattaagaagacacaaaaacaactagcaagcac |
50078704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 57
Target Start/End: Original strand, 50069988 - 50070016
Alignment:
| Q |
29 |
attacattggaagattaagaagacacaaa |
57 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
50069988 |
attacattggaagattaagaagacacaaa |
50070016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 102 - 224
Target Start/End: Original strand, 10797113 - 10797235
Alignment:
| Q |
102 |
acttggtaaattggaggatggattagttgtaattaggattggccaaaacataaccctcaatggccttgaaaagagcatcacccttggctttgccttcctc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10797113 |
acttggtaaattggaggatggattagttgtaattaggattggccaaaacataaccctcaatggccttgaaaagagcatcccccttggctttgccttcctc |
10797212 |
T |
|
| Q |
202 |
aacctccttttcaattggcttag |
224 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10797213 |
aacctccttttcaattggcttag |
10797235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 16 - 73
Target Start/End: Original strand, 10797057 - 10797114
Alignment:
| Q |
16 |
aagaaaaaactttattacattggaagattaagaagacacaaaaacaactagcaagcac |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10797057 |
aagaaaaaactttattacattggaagattaagaagacacaaaaacaactagcaagcac |
10797114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 124 - 195
Target Start/End: Complemental strand, 13501575 - 13501504
Alignment:
| Q |
124 |
ttagttgtaattaggattggccaaaacataaccctcaatggccttgaaaagagcatcacccttggctttgcc |
195 |
Q |
| |
|
||||||||||| |||||| |||||| |||||||||| ||||||||||||| |||||||||| |||||||| |
|
|
| T |
13501575 |
ttagttgtaatcaggattagccaaacagtaaccctcaagggccttgaaaagaccatcacccttagctttgcc |
13501504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 124 - 195
Target Start/End: Complemental strand, 13515378 - 13515307
Alignment:
| Q |
124 |
ttagttgtaattaggattggccaaaacataaccctcaatggccttgaaaagagcatcacccttggctttgcc |
195 |
Q |
| |
|
||||||||||| |||||| |||||| |||||||| || |||||||||||| |||||||||| |||||||| |
|
|
| T |
13515378 |
ttagttgtaatcaggattagccaaacagtaaccctctatagccttgaaaagaccatcacccttagctttgcc |
13515307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 130 - 170
Target Start/End: Complemental strand, 13541914 - 13541874
Alignment:
| Q |
130 |
gtaattaggattggccaaaacataaccctcaatggccttga |
170 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
13541914 |
gtaattagggtttgccaaaacataaccctcaatggccttga |
13541874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 195
Target Start/End: Complemental strand, 13485853 - 13485788
Alignment:
| Q |
130 |
gtaattaggattggccaaaacataaccctcaatggccttgaaaagagcatcacccttggctttgcc |
195 |
Q |
| |
|
||||| |||||| |||||||| ||||| |||| |||||||||||| |||||||| | |||||||| |
|
|
| T |
13485853 |
gtaatcaggatttgccaaaacgtaaccttcaagagccttgaaaagaccatcacccctagctttgcc |
13485788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 195
Target Start/End: Complemental strand, 13509614 - 13509549
Alignment:
| Q |
130 |
gtaattaggattggccaaaacataaccctcaatggccttgaaaagagcatcacccttggctttgcc |
195 |
Q |
| |
|
||||| |||||| |||||||||||||| |||| || ||||||||| |||||||| | |||||||| |
|
|
| T |
13509614 |
gtaatcaggatttgccaaaacataaccttcaagagctttgaaaagaccatcacccctagctttgcc |
13509549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University