View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15720_low_47 (Length: 213)
Name: NF15720_low_47
Description: NF15720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15720_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 103 - 200
Target Start/End: Complemental strand, 35902671 - 35902574
Alignment:
| Q |
103 |
tatgttgcatttccagattagggactcaattcttggcactctacttaaaagtttgaggaactcttaaacgtgttacgaatgactttcctgccatatat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35902671 |
tatgttgcatttccagattagggactcaattcttggcactctatttaaaagtttgaggaactcttaaacgtgttatgaatgactttcctgccatatat |
35902574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 13 - 54
Target Start/End: Complemental strand, 35902751 - 35902710
Alignment:
| Q |
13 |
aaatgaatataaaatgagactatattatgaccaaactgaatt |
54 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35902751 |
aaatgaataaaaaatgagactatattatgaccaaactgaatt |
35902710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University