View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15721_high_3 (Length: 277)
Name: NF15721_high_3
Description: NF15721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15721_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 6 - 265
Target Start/End: Complemental strand, 29776643 - 29776384
Alignment:
| Q |
6 |
attttcattatcattcatccttccacttgagttttggaaatctctttgtatataatataatgaataatgatattttcttttatacatacaggccggttac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29776643 |
attttcattatcattcatccttccacttgagttttggaaatctctttgtatataatataatgaataatgatattttctttgatacatacaggccggttac |
29776544 |
T |
 |
| Q |
106 |
cgtcacattgattgtgctcaattatatggcaatcagaaggaggtagctannnnnnnnnnnnnnnnnnnaatgttaatgcatataatatgtgaaggaaatg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29776543 |
cgtcacattgattgtgctcaattatatggcaatcagaaggaggtagctatttcattttttgttttcttaatgttaatgcatataatatgtgaaggaaatg |
29776444 |
T |
 |
| Q |
206 |
attcattgatttcttctcttgtttgcagattggcttggtgttgaagaagttgttggatga |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29776443 |
attcattgatttcttctcttgtttgcagattggcttggtgttgaagaagttgttcgatga |
29776384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 92 - 150
Target Start/End: Complemental strand, 29786906 - 29786848
Alignment:
| Q |
92 |
tacaggccggttaccgtcacattgattgtgctcaattatatggcaatcagaaggaggta |
150 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
29786906 |
tacaggctggttaccgtcacattgattgtgctcaagtctatggcaatgagaaggaggta |
29786848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University