View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15723_low_1 (Length: 236)
Name: NF15723_low_1
Description: NF15723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15723_low_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 36 - 218
Target Start/End: Complemental strand, 488547 - 488365
Alignment:
| Q |
36 |
ggtttatgtgacataccaacacgaccaagggatatggcttcagttccaagcaacatgaaatcattgcaatgttccatgctagcaatgacaccattaccat |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488547 |
ggtttatgtgacataccaacacgaccaagggatatggcttcagttccaagcaacatgaaatcattgcaatgttccatgctagcaatgacaccattaccat |
488448 |
T |
 |
| Q |
136 |
tgaaatgtcttttcactgaagttgagagagctttgtaatatgctttggccaaatcaactcttccaccatacttctcacccacc |
218 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488447 |
tgaaatgttttttcactgaagttgagagagctttgtaatatgctttggccaaatcaactcttccaccatacttctcacccacc |
488365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 143
Target Start/End: Original strand, 43638210 - 43638307
Alignment:
| Q |
46 |
acataccaacacgaccaagggatatggcttcagttccaagcaacatgaaatcattgcaatgttccatgctagcaatgacaccattaccattgaaatgt |
143 |
Q |
| |
|
|||||||||| || ||||| || |||| ||| || ||||| ||||||||||| ||||| |||| ||| || | |||||||||||| || ||||||||| |
|
|
| T |
43638210 |
acataccaactcgtccaagtgaaatggtttctgtaccaaggaacatgaaatcgttgcattgttgcatactggaaatgacaccattgcctttgaaatgt |
43638307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 54 - 207
Target Start/End: Original strand, 34697240 - 34697393
Alignment:
| Q |
54 |
acacgaccaagggatatggcttcagttccaagcaacatgaaatcattgcaatgttccatgctagcaatgacaccattaccattgaaatgtcttttcactg |
153 |
Q |
| |
|
||||| |||||||| |||||||| || ||||| | | ||| || |||||||| |||||||| ||||| || ||||| |||||||||||| | ||||||| |
|
|
| T |
34697240 |
acacgtccaagggaaatggcttctgtgccaaggagaaagaagtcgttgcaatgctccatgctggcaataactccattgccattgaaatgtttcttcactg |
34697339 |
T |
 |
| Q |
154 |
aagttgagagagctttgtaatatgctttggccaaatcaactcttccaccatact |
207 |
Q |
| |
|
| | | || ||||||||||| ||||| || | ||||| | ||||||||||| |
|
|
| T |
34697340 |
atgaggtcagtgctttgtaataggctttagcaagctcaacacgtccaccatact |
34697393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University