View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15723_low_2 (Length: 234)
Name: NF15723_low_2
Description: NF15723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15723_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 13 - 217
Target Start/End: Complemental strand, 37101 - 36896
Alignment:
| Q |
13 |
catcaaaaccgattttagcgaaaacttcccactacagtagtaaagcaggtcatcgagactcgggcccataagttcaagaactagaacattatagtctccg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37101 |
catcaaaaccgattttagcgaaaacttcccactgcagtagtaaagcaggtcatcgagactcgggcccataagttcaagaactagaacattatagtctccg |
37002 |
T |
 |
| Q |
113 |
tcagtaccaaaccatttcaaacttggaattcctccttaaattccattactataataaattaaaaaggactgatgaaacaaagcg-aaaatattgtgaggg |
211 |
Q |
| |
|
||||||||||||||||||| |||||||| || |||||||||||||||||||||||||||| |||||||||| |||||||| | ||||||||||||||| |
|
|
| T |
37001 |
tcagtaccaaaccatttcattcttggaataccaccttaaattccattactataataaattagaaaggactgagaaaacaaagggaaaaatattgtgaggg |
36902 |
T |
 |
| Q |
212 |
aaacaa |
217 |
Q |
| |
|
|||||| |
|
|
| T |
36901 |
aaacaa |
36896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University