View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15724_low_2 (Length: 321)
Name: NF15724_low_2
Description: NF15724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15724_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 133 - 303
Target Start/End: Complemental strand, 25501882 - 25501718
Alignment:
| Q |
133 |
taagggtgtgtttaggaggaaatcaccaaattggtctttgacnnnnnnnnnnnnggcggtctcaaattagtatctaaggtcacaaatttaaaataacttc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25501882 |
taagggtgtgtttaggaggaaatcaccaaattggtctttgactatata------ggcggtctcaaattagtatctaaggtcacaaatttaaaataacttc |
25501789 |
T |
 |
| Q |
233 |
gagtactcaagttagtctatttataatctcttgacctgacacagtctcaactgctgatatggccactaaac |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25501788 |
gagtactcaagttagtctatttataatctcttgacctgacacagtctcaactgctgatatggccactaaac |
25501718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 25501965 - 25501884
Alignment:
| Q |
1 |
tgttggttacactctttgaagagaaaatcacatgnnnnnnnn-cctttccattccaagttatgtaaatggttgtagaaatat |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25501965 |
tgttggttacactctttgaagagaaaatcacatgtttttttttcctttccattccaagttatgtaaatggttgtagaaatat |
25501884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University