View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15724_low_4 (Length: 262)
Name: NF15724_low_4
Description: NF15724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15724_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 75 - 248
Target Start/End: Complemental strand, 9135298 - 9135125
Alignment:
| Q |
75 |
gtttacttttttatgcaaatttcagatttttcgcttttgtgtttgaatttagcttctgggtattattataatttcttattctttgatttttatgaaaaca |
174 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9135298 |
gtttaattttttatgcaaatttcagatttttcgctgttgtgtttgaatttagcttctgggtattattataatttcttattctttgatttttatgaaaaca |
9135199 |
T |
|
| Q |
175 |
gttgagttagggaagcagatttcattcactaagaagttgcttaacaagtcagatcgctatgtggctttcaaggt |
248 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9135198 |
gttgagttagggaagctgatttcattcactaagaagttgcttaacaagtcagatcgctatgtggctttcaaggt |
9135125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 101 - 228
Target Start/End: Complemental strand, 9310303 - 9310176
Alignment:
| Q |
101 |
tttttcgcttttgtgtttgaatttagcttctgggtattattataatttcttattctttgatttttatgaaaacagttgagttagggaagcagatttcatt |
200 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||| |||||| || ||||||||||||| |||| |||||||| || |||||||||| |||| |
|
|
| T |
9310303 |
tttttggcttttgtgtttggttttagcttctgggtattattctaattttttgttctttgatttttgtgaacacagttgaattgaggaagcagatctcatg |
9310204 |
T |
|
| Q |
201 |
cactaagaagttgcttaacaagtcagat |
228 |
Q |
| |
|
| || | ||||| ||||||||||||| |
|
|
| T |
9310203 |
ctctttgcagttgtctaacaagtcagat |
9310176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University