View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15724_low_5 (Length: 255)
Name: NF15724_low_5
Description: NF15724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15724_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 10 - 239
Target Start/End: Original strand, 29004287 - 29004516
Alignment:
| Q |
10 |
ataatactgaaaatgatcggtgcgcaacacatgtgtgtcacattatagagatttatagctctatatatatcagatgctgcagtgtttctgatacaaatgt |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29004287 |
ataatattgaaaatgatcggtgcgcaacacatgtgtgtcacattatagagatttatagctctatatatatcagatgctgcagtgtttctgatacaaatgt |
29004386 |
T |
|
| Q |
110 |
ttgtacctcctcttgcagctacaccccaagtgaatgtccaaccattacaatggaacataggtaatgtccatagataaactggttcactacccatttccca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29004387 |
ttgtacctcctcttgcagctacaccccaagtgaatgtccaaccattacaatggaacataggtaatgtccatagataaactggttcactacccatttccca |
29004486 |
T |
|
| Q |
210 |
accaaggattaaactcaaagtacttaaata |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29004487 |
accaaggattaaactcaaagtacttaaata |
29004516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University