View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15725_high_13 (Length: 227)
Name: NF15725_high_13
Description: NF15725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15725_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 209
Target Start/End: Complemental strand, 32789323 - 32789131
Alignment:
| Q |
17 |
gaagagtacagtgattgtgccaaaagttggaggacaatatggtaatattacaagcgaccaatcaccaagagttgagctatactctgaaagaaggggtgaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32789323 |
gaagagtacagtgattgtgccaaaagttggaggacaatatggtaatattacaagcgaccaatcaccaagagttgagctatactctgaaagaaggggtgaa |
32789224 |
T |
 |
| Q |
117 |
gatttagatagttcaaactatttgatgcaaatgaaggattgttcacctcacaatatggtaaatgagacttctctcaatatcaatggtacatca |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32789223 |
gatttagatagttcaaattatttgatgcaaatgaaggattgttcaccacacaatatggtaaatgagacttctctcaatatcaatggtacatca |
32789131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University