View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15725_low_11 (Length: 303)
Name: NF15725_low_11
Description: NF15725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15725_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 17 - 153
Target Start/End: Original strand, 34755706 - 34755842
Alignment:
| Q |
17 |
agaaagcactcaaaatagcctttgtttgctactgctgcaactgtttacatctcagaagaaagtgttttaagtgttcccctcgaatgatcagcctttctat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
34755706 |
agaaagcactcaaaatagcctttgtttgctactgttgcaactgtttacatctcagaagaaagtgttttaagtgttcccctcgtatgatcagcctttccat |
34755805 |
T |
|
| Q |
117 |
ttttaccttaatttagaccatcatctttgggattact |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34755806 |
ttttaccttaatttagaccatcatctttgggattact |
34755842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 182 - 290
Target Start/End: Original strand, 34756300 - 34756408
Alignment:
| Q |
182 |
attttggtcaagtgttgcaacattattttactagtgaaccatagacaactattctctttttcatgtatcattttgttgaatgaatttctcactttcttct |
281 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34756300 |
attttggtcaagtgttgcaacattatttgactagtgaaccatagacagctattctctttttcatgtatcattttgttgaatgaatttctcactttcttct |
34756399 |
T |
|
| Q |
282 |
tattcatct |
290 |
Q |
| |
|
||||||||| |
|
|
| T |
34756400 |
tattcatct |
34756408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University