View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15725_low_12 (Length: 292)
Name: NF15725_low_12
Description: NF15725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15725_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 53 - 286
Target Start/End: Original strand, 32789553 - 32789786
Alignment:
| Q |
53 |
ggagaacctgcaaactaggagtggtttcacattccctctcatcaagtcgatattcatgcataacccaatttgtacgagagccatggggtgctcttcctcg |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32789553 |
ggagaacctgcaaactaggagtggtttcacattccctctcatcaagtcgatattcatgcataacccaatttgtacgagagccatggggtgctcttcctcg |
32789652 |
T |
|
| Q |
153 |
atagtaaactagggttttcttcacccctactgctcgagcttgagaattcacctttcgatccttcccagttgccttccaatatccagatttggttgcacga |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32789653 |
atagtaaactagggttttcttcacccctactgctcgagcttgagaattcacctttcgatccttcccagttgccttccaatatccagatttggttgcacga |
32789752 |
T |
|
| Q |
253 |
ttcgttctagatccattcgggtacttcttatcac |
286 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
32789753 |
ttcgttctagatccattcgggtacttcctatcac |
32789786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 79 - 284
Target Start/End: Complemental strand, 29103239 - 29103034
Alignment:
| Q |
79 |
tcacattccctctcatcaagtcgatattcatgcataacccaatttgtacgagagccatggggtgctcttcctcgatagtaaactagggttttcttcaccc |
178 |
Q |
| |
|
|||||||| || |||||||| ||||| ||||||||||||||| || ||||| ||||| ||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
29103239 |
tcacattctctttcatcaagacgatactcatgcataacccaaccagtgcgagatccatgtggtgctcttcctctatagtaaactagggttttcttcattc |
29103140 |
T |
|
| Q |
179 |
ctactgctcgagcttgagaattcacctttcgatccttcccagttgccttccaatatccagatttggttgcacgattcgttctagatccattcgggtactt |
278 |
Q |
| |
|
| || || |||| |||| ||||||||| ||||| ||||| ||||||||||||||||||||||| ||||| | ||| ||||| |||||||| || ||||| |
|
|
| T |
29103139 |
caacggcgcgagtctgagcattcaccttgcgatctttccccgttgccttccaatatccagattttgttgctctattggttcttgatccatttggatactt |
29103040 |
T |
|
| Q |
279 |
cttatc |
284 |
Q |
| |
|
| |||| |
|
|
| T |
29103039 |
cctatc |
29103034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University