View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15725_low_13 (Length: 284)
Name: NF15725_low_13
Description: NF15725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15725_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 21 - 103
Target Start/End: Complemental strand, 30854448 - 30854366
Alignment:
| Q |
21 |
catgcatggacaaattaagctggaatctttagacagctagctttagtctatcaccataatatgtgtcttgtcattttgtaaac |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30854448 |
catgcatggacaaattaagctggaatctttagacagctagctttagtctatcaccataatatgtgtcttgtcattttgtaaac |
30854366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 181 - 224
Target Start/End: Complemental strand, 30854288 - 30854245
Alignment:
| Q |
181 |
catgttgtgtcttgcaagttttcctccttaatattttgttcaat |
224 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30854288 |
catgttgtgccttgcaagttttcctccttaatattttgttcaat |
30854245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 21 - 85
Target Start/End: Complemental strand, 30878647 - 30878581
Alignment:
| Q |
21 |
catgcatggacaaattaagctggaatct--ttagacagctagctttagtctatcaccataatatgtg |
85 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
30878647 |
catgcatggacaaattaagctagaatctctttagatagctagctctagtttatcaccataatatgtg |
30878581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 237 - 268
Target Start/End: Complemental strand, 30854222 - 30854191
Alignment:
| Q |
237 |
tctcagtcaaatgttgagttcagctacattgt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30854222 |
tctcagtcaaatgttgagttcagctacattgt |
30854191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 21 - 97
Target Start/End: Original strand, 15064233 - 15064309
Alignment:
| Q |
21 |
catgcatggacaaattaagctggaatctttagacagctagctttagtctatcaccataatatgtgtcttgtcatttt |
97 |
Q |
| |
|
||||||||||||||||||||| |||||| | ||| |||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
15064233 |
catgcatggacaaattaagctagaatctctcaacaactagctctagtatatctccataatatgtgtcttgtcatttt |
15064309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University