View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15725_low_15 (Length: 281)
Name: NF15725_low_15
Description: NF15725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15725_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 12 - 134
Target Start/End: Original strand, 49581400 - 49581527
Alignment:
| Q |
12 |
cttcacccacagagttcaaccctcgttcattagtaatcattaaacttcttctttaa-----cagcaaggtaacaactttctctttataatatacacaaca |
106 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49581400 |
cttcacccacatagttcaaccctcgttcattagtaatcattaaacttcttctttcataacgcagcaaggtaacaactttctctttataatatacacaaca |
49581499 |
T |
|
| Q |
107 |
gctctacgtgcatgtgtgcgtgcatgta |
134 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
49581500 |
actctacgtgcatgtgtgcgtgcatgta |
49581527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 194 - 281
Target Start/End: Original strand, 49581588 - 49581675
Alignment:
| Q |
194 |
cttcacgttttctttattttcaatctacaacttacagatcggtgtataaccatcatgatccgtttttgcagcttcatgcgggtctccc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49581588 |
cttcacgttttctttattttcaatctacaacttacagatcggtgtattaccatcatgatccgtttttgcagcttcatgcgggtctccc |
49581675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University