View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15725_low_16 (Length: 276)
Name: NF15725_low_16
Description: NF15725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15725_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 42 - 263
Target Start/End: Complemental strand, 7343095 - 7342873
Alignment:
| Q |
42 |
atttacatacataaaacatatacacaannnnnnnn-agctattactctttctgtgacaatgattacttcaatcaacaataaaatactgtgtcatctacat |
140 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7343095 |
atttacatacataaaacatatacacaatttttttttagctataactctttctgtgacaatgattacttcaatcaacaataaaatactgtgtcatctacat |
7342996 |
T |
 |
| Q |
141 |
tattgttgtacagatacaaaagggataaccataaaagcataaggatacatgtatattatctttttgcagnnnnnnnnctctgctttttctgttgtatcac |
240 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7342995 |
tattgttgtacaaatacaaaagggataaccataaaagcataaggatatatgtatattatctttttgcagtttttattctctgctttttctgttgtatcac |
7342896 |
T |
 |
| Q |
241 |
atgtcatattttgttactttttc |
263 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7342895 |
atgtcatattttgttactttttc |
7342873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University