View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15725_low_19 (Length: 262)
Name: NF15725_low_19
Description: NF15725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15725_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 247
Target Start/End: Complemental strand, 45359565 - 45359338
Alignment:
| Q |
18 |
aatatttgtgatgcttgttcttttgccttctgattactgtttgtattttcattgttctcatttttgtttgttgattgggaataaagtctaggggtttaac |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45359565 |
aatatttgagatgcttgttcttttgccttctgattactgtttgtattttcattgttctcatttttgtt----gattgggaataaagtctaggggtttaac |
45359470 |
T |
 |
| Q |
118 |
tttggggcatctgaggagttgctgtttatttattttaccctttgctgctc--tgttatcatgagtggtgtttgaatccaaaagactgtttaataaggtag |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45359469 |
tttggggcatctgaggagttgctgttcatttattttaccctttgctgctctgtgttatcatgagtggtgtttgaatccaaaagactgttttataaggtag |
45359370 |
T |
 |
| Q |
216 |
ctgtgtgtttataggaggggggctgctgctgg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45359369 |
ctgtgtgtttataggaggggggctgctgctgg |
45359338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University