View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15725_low_21 (Length: 246)
Name: NF15725_low_21
Description: NF15725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15725_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 76 - 236
Target Start/End: Original strand, 2696763 - 2696924
Alignment:
| Q |
76 |
tccttgcttctcatctctcgcgtttcattcagttcaactaatgtcagatttccttttcagttttctttcatatacttttgtggtgataaaaaattcctac |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2696763 |
tccttgcttctcatctctcgcgtttcattcagttcaactaatgtcagatttgcttttcagtttgctttcatatacttttgtggtgataaaatattcctac |
2696862 |
T |
|
| Q |
176 |
acttatgacatattccgttttac-tatgtttgatttgcatctgcttagtgtgtcctgttcat |
236 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2696863 |
acttatgacatattccgttttacttatgtttgatttgcatctgcttagtgtgtcctgttcat |
2696924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 21 - 80
Target Start/End: Original strand, 2694145 - 2694204
Alignment:
| Q |
21 |
aaggaaatgattagttgggttgattcctattactttcacatcgcctacctccttctcctt |
80 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2694145 |
aaggaaatgattagttgagttgattcctattactttcacatcgcctaccttcttctcctt |
2694204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University