View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15725_low_23 (Length: 229)
Name: NF15725_low_23
Description: NF15725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15725_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 13 - 93
Target Start/End: Original strand, 27446524 - 27446606
Alignment:
| Q |
13 |
gagatgaactaggatacgttattctcatcatcttaattgctcactaaaagaatattaca--tttgtttaaagagaatctaata |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27446524 |
gagatgaactaggatacgttattctcatcatcttaattgctcactaaaagaatattacatttttgtttaaagagaatctaata |
27446606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 27446768 - 27446837
Alignment:
| Q |
141 |
tatgtaatatagtttcttttttacaaactggggcaaatgcaatgtatttcacaggccagttggaatcatc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27446768 |
tatgtaatatagtttcttttttacaaactggggcaaatgcaatgtatttcacaggccagttggaatcatc |
27446837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University