View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15725_low_25 (Length: 215)
Name: NF15725_low_25
Description: NF15725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15725_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 4 - 197
Target Start/End: Original strand, 40482501 - 40482694
Alignment:
| Q |
4 |
taagaatcaaactaaataactaggagacgcattttaaggatgtttcgtaattttggttaatttaggattgtagggacaatatctgacacattcaaggacc |
103 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40482501 |
taagaatcaaactaaataactacgagacgctttttaaggatgttttgtaattttggttaattagggattgtagggacaatatctgacacattcaaggacc |
40482600 |
T |
|
| Q |
104 |
aaagtggccttttaaacataaacaaacagactcatatgtacctgaggaagaggcaatgcggcaataaagtctaaccaaaaacccttgctgaagt |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40482601 |
aaagcggccttttaaacataaacaaacagactcataggtacctgaggaagaggcaatgcggcaataaagtctaaccaaaaacccttgctgaagt |
40482694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 4 - 197
Target Start/End: Original strand, 40513175 - 40513368
Alignment:
| Q |
4 |
taagaatcaaactaaataactaggagacgcattttaaggatgtttcgtaattttggttaatttaggattgtagggacaatatctgacacattcaaggacc |
103 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40513175 |
taagaatcaaactaaataactacgagacgctttttaaggatgttttgtaattttggttaattagggattgtagggacaatatctgacacattcaaggacc |
40513274 |
T |
|
| Q |
104 |
aaagtggccttttaaacataaacaaacagactcatatgtacctgaggaagaggcaatgcggcaataaagtctaaccaaaaacccttgctgaagt |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40513275 |
aaagcggccttttaaacataaacaaacagactcataggtacctgaggaagaggcaatgcggcaataaagtctaaccaaaaacccttgctgaagt |
40513368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University