View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15725_low_9 (Length: 311)
Name: NF15725_low_9
Description: NF15725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15725_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 156 - 290
Target Start/End: Complemental strand, 40577793 - 40577659
Alignment:
| Q |
156 |
ggtgcagcctaaggttatcatagtgattctgaaagttcacatgcattgtgaagcttgttcacaagaaatcaagagacgcattgagaaaatcaaaggtatg |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40577793 |
ggtgcagcctaaggttatcatagtgattctgaaagttcacatgcattgtgaagcttgttcacaagaaatcaagagacgcattgagaaaatcaaaggtatg |
40577694 |
T |
 |
| Q |
256 |
ttactgtgttctgttttgattgaaattcagatttt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40577693 |
ttactgtgttctgttttgattgaaattcagatttt |
40577659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 187 - 227
Target Start/End: Complemental strand, 734308 - 734268
Alignment:
| Q |
187 |
aaagttcacatgcattgtgaagcttgttcacaagaaatcaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||| || | |||||||| |
|
|
| T |
734308 |
aaagttcacatgcattgtgaagcttgtgcagaggaaatcaa |
734268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 187 - 227
Target Start/End: Complemental strand, 45390701 - 45390661
Alignment:
| Q |
187 |
aaagttcacatgcattgtgaagcttgttcacaagaaatcaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||| || | |||||||| |
|
|
| T |
45390701 |
aaagttcacatgcattgtgaagcttgtgcagaggaaatcaa |
45390661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University