View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15726_high_4 (Length: 324)
Name: NF15726_high_4
Description: NF15726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15726_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 19 - 306
Target Start/End: Original strand, 371365 - 371657
Alignment:
| Q |
19 |
ctaattaacacacaacacaaagtatatacatgttgattgacttgagattggaaatgaacattgaa---------attatatggtgaggttgtgcttaatt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
371365 |
ctaattaacacacaacacaaagtatatacatgttgattgacttgagattggaaatgaacattgaagaataagaaattatatggtgaggttgtgctt---- |
371460 |
T |
 |
| Q |
110 |
ggtgggtggaatattattatcagcagctttcaaggtcttttcaataagcttacgagcttttctgcttcgaatctcaaccttaacacttgcactcttgtcc |
209 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
371461 |
ggtggggggaatattattatcagcagctttcaaggtcttttcaataagcttacgagcttttctgcttcgaatctcaaccttaacacttgcactcttgtcc |
371560 |
T |
 |
| Q |
210 |
atctttatgtatggcttctttcctttcttcatcttcaacgttgacttcacctttgactttattgattccaccagatttccaagctgattcgccattc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
371561 |
atctttatgtatggcttctttcctttcttcatcttcaacgttgacttcacctttgactttattgattccaccagatttccaagttgattcgccattc |
371657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University