View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15728_high_3 (Length: 327)

Name: NF15728_high_3
Description: NF15728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15728_high_3
NF15728_high_3
[»] chr4 (1 HSPs)
chr4 (3-317)||(26536410-26536724)


Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 3 - 317
Target Start/End: Original strand, 26536410 - 26536724
Alignment:
3 gtcataaaattggtctgtgttgttgtggtggagggnnnnnnnngggagtgatgatgccggatgagattgctgctcgtgcatatcgcgatggtgaaagagt 102  Q
    |||||||||||||||||||||||||||||||||||        | ||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
26536410 gtcataaaattggtctgtgttgttgtggtggagggaaaaaaaagagagtgatgatgccggatgagattgctgctcgcgcatatcgcgatggtgaaagagt 26536509  T
103 ggatgctgcaatgcatggttatagttatctatcaccatggatggctcattggaagcacacaagttacaagtcaaacacacaaaagactgtttgcaacaat 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26536510 ggatgctgcaatgcatggttatagttatctatcaccatggatggctcattggaagcacacaagttacaagtcaaacacacaaaagactgtttgcaacaat 26536609  T
203 ggtttgagtgttggttgtgaggttaatgaattgaaagaagaaagtgatgttgagaagcgtgatttacttggtgggtcggacgttggatcagatagttcta 302  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26536610 ggtttgagtgttggttgtgaggttaatgaattgaaagaagaaagtgatgttgagaagcgtgatttacttggtgggtcggacgttggatcagatagttcta 26536709  T
303 tgcatgttgatgatg 317  Q
    |||||||||||||||    
26536710 tgcatgttgatgatg 26536724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University