View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15728_low_4 (Length: 327)
Name: NF15728_low_4
Description: NF15728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15728_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 3 - 317
Target Start/End: Original strand, 26536410 - 26536724
Alignment:
| Q |
3 |
gtcataaaattggtctgtgttgttgtggtggagggnnnnnnnngggagtgatgatgccggatgagattgctgctcgtgcatatcgcgatggtgaaagagt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26536410 |
gtcataaaattggtctgtgttgttgtggtggagggaaaaaaaagagagtgatgatgccggatgagattgctgctcgcgcatatcgcgatggtgaaagagt |
26536509 |
T |
|
| Q |
103 |
ggatgctgcaatgcatggttatagttatctatcaccatggatggctcattggaagcacacaagttacaagtcaaacacacaaaagactgtttgcaacaat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26536510 |
ggatgctgcaatgcatggttatagttatctatcaccatggatggctcattggaagcacacaagttacaagtcaaacacacaaaagactgtttgcaacaat |
26536609 |
T |
|
| Q |
203 |
ggtttgagtgttggttgtgaggttaatgaattgaaagaagaaagtgatgttgagaagcgtgatttacttggtgggtcggacgttggatcagatagttcta |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26536610 |
ggtttgagtgttggttgtgaggttaatgaattgaaagaagaaagtgatgttgagaagcgtgatttacttggtgggtcggacgttggatcagatagttcta |
26536709 |
T |
|
| Q |
303 |
tgcatgttgatgatg |
317 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
26536710 |
tgcatgttgatgatg |
26536724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University