View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15728_low_5 (Length: 253)
Name: NF15728_low_5
Description: NF15728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15728_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 234
Target Start/End: Original strand, 4630071 - 4630302
Alignment:
| Q |
20 |
tggggcagaaaaatgtcattgcaggagtgagttaagaatgctaagctagatgtatggacatactatacgagataggatgacacgttgaaaatatgaagat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4630071 |
tggggcagaaaaatgtcattgcaggagtgagttaagaatgctaagctagatgtatggaaataccatacgagataggatgacacgttgaaaacatgaagat |
4630170 |
T |
|
| Q |
120 |
aacacaaca-----------------agtagcccgtctagctcagtgatgaattttatgcttcattcttgattctatatttgtaagtaaaattcatgcat |
202 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4630171 |
aacacaacaagtagaaaaacataacaagtagcccgtctagctcagtgatggattttatgcttcattcttgattctatatttgtaagtaaaattcatgcat |
4630270 |
T |
|
| Q |
203 |
tttaacaagtaaactgggtctagcagaagtgt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4630271 |
tttaacaagtaaactgggtctagcagaagtgt |
4630302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University