View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15729_low_4 (Length: 421)
Name: NF15729_low_4
Description: NF15729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15729_low_4 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 307 - 421
Target Start/End: Complemental strand, 2694108 - 2693992
Alignment:
| Q |
307 |
atgctctgtgttttagtttgctaagcggggtttctnnnnnnnt--gcgcactacaatgcatattatttggttagcatctgggtaaattggagtgaacaaa |
404 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2694108 |
atgctccgtgtattagtttgctaagcggggtttctaaaaaaatatgcgcactacaatgcatattatttggttagcatctgggtaatttggagtgaacaaa |
2694009 |
T |
 |
| Q |
405 |
atcaccgtaggtcaaaa |
421 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
2694008 |
atcaccgtaggtcaaaa |
2693992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University