View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15729_low_9 (Length: 262)
Name: NF15729_low_9
Description: NF15729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15729_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 33231223 - 33230978
Alignment:
| Q |
1 |
ctagaacttgaagacgatatatgtttcggtggtggtatccaattgtggataaaaagagttcaatccgattttcttcacttcagctacaacagcgaccaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33231223 |
ctagaacttgaagacgatatatgtttcggtggtggtatccaattgtggataaaaagagttcaatccgattttcttcacttcagctacaacagcgaccaaa |
33231124 |
T |
|
| Q |
101 |
gatttcaagttgttacaaccttcaaattcaaagagacctttgattcccatggttgtattatgacttgggttttttgttatggtagggcaggcaaaggggg |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33231123 |
gatttcaagttattacaaccttcaaattcaaagagacctttaattcccatggttgtattatgacttgggttttttgttatggtagggcaggcaaaggggg |
33231024 |
T |
|
| Q |
201 |
ccttattgttgtggaggggaagaaaagaagtaaagaggataaatac |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33231023 |
ccttattgttgtggaggggaagaaaagaagtaaagaggataaatac |
33230978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University