View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1572_high_5 (Length: 239)
Name: NF1572_high_5
Description: NF1572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1572_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 97 - 221
Target Start/End: Complemental strand, 7153342 - 7153219
Alignment:
| Q |
97 |
tatatatctctagataacttaacaagtttccaaagatgaatcttccacaaagcctatttatcatatgataaattcgtttcatacaaaagacaaaaaggta |
196 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7153342 |
tatatatctctagatagcttaacaagtttccaa-gatgaatcttctacaaagtctatttatcatatgataaattcgtttcatacaaaagacaaaaaggta |
7153244 |
T |
|
| Q |
197 |
aggtaaataggaacccctagtcaaa |
221 |
Q |
| |
|
|||||||||||| |||||||||||| |
|
|
| T |
7153243 |
aggtaaataggatcccctagtcaaa |
7153219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 7153391 - 7153343
Alignment:
| Q |
1 |
atttatccaagaaatagaatgtatattgtgagactcatgagtatccaac |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7153391 |
atttatccaagaaatagaatgtatcttgtgagactcatgagtatccaac |
7153343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University