View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1572_low_3 (Length: 319)
Name: NF1572_low_3
Description: NF1572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1572_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 18 - 277
Target Start/End: Complemental strand, 37447224 - 37446966
Alignment:
| Q |
18 |
tattaaatccttgtatcaaagcttagcggtatagtccagtggtgtgttctgttagttgtaacgatggtggaagtttaagatgtaggagacccacacttaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37447224 |
tattaaatccttgtatcaaagcttagcggtatagtccagtggtgtgttctgttagttgtaacgatggtggaagtttaagatgtaggagacccacacttaa |
37447125 |
T |
 |
| Q |
118 |
ggggggatatattgtttggttcaagtgtgagtttaatatcaaatgacttaaaggttttggaaggagacctctagtggttctcaaccattactctcttgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37447124 |
ggggggatatattgtttggttcaagtgtgagtttaatatcaaatgacttaaaggttttggaaggagacctctagtggttctcaaccattactctcttgtt |
37447025 |
T |
 |
| Q |
218 |
actctaggcaatctcagactcacttgggtggcctgatagtgttggcttgggaccttcaag |
277 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37447024 |
actctaggcaatct-agactcacttgggtggtctgatagtgttggcttgggaccttcaag |
37446966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 277 - 307
Target Start/End: Complemental strand, 37446951 - 37446921
Alignment:
| Q |
277 |
ggtcttaggttcgacttttcccagtaccaat |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37446951 |
ggtcttaggttcgacttttcccagtaccaat |
37446921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University