View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1572_low_7 (Length: 239)
Name: NF1572_low_7
Description: NF1572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1572_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 85 - 223
Target Start/End: Complemental strand, 44129719 - 44129581
Alignment:
| Q |
85 |
ctctctctgagtgtaagtgttatagttttgttgatgagaagaaacaaagtggtattgttgtcgatataaaatcttttgtctagatcgaaaggcttgtgta |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44129719 |
ctctctctgagtgtaagtgttatagttttgttgatgagaagaaacaaagtggtattgttgtcgatataaaatcttttgtctagatcgaaaggcttgtgtg |
44129620 |
T |
|
| Q |
185 |
gtttggtgtagaaaatcatgcaggagaacggaatatatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44129619 |
gtttggtgtagaaaatcatgcaggagaacggaatatatt |
44129581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 11 - 69
Target Start/End: Complemental strand, 44129822 - 44129764
Alignment:
| Q |
11 |
gaagaatattatgttacctgtgtacttagattgcatgctttgtcactgtcttccttccc |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44129822 |
gaagaatattatgttacctgtgtacttagattgcatgctttgtcactgtcttccttccc |
44129764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University