View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1573-INSERTION-2 (Length: 70)
Name: NF1573-INSERTION-2
Description: NF1573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1573-INSERTION-2 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 60; Significance: 2e-26; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 2e-26
Query Start/End: Original strand, 7 - 70
Target Start/End: Original strand, 6530777 - 6530840
Alignment:
| Q |
7 |
atcttccatagctctcaagtagatccaaagtgtgtgtatactccattttccattttcgtgtgat |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6530777 |
atcttccatagctctcaagtagatccaaagtgtgtatatactccattttccattttcgtgtgat |
6530840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.00000008
Query Start/End: Original strand, 13 - 41
Target Start/End: Original strand, 36283736 - 36283764
Alignment:
| Q |
13 |
catagctctcaagtagatccaaagtgtgt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36283736 |
catagctctcaagtagatccaaagtgtgt |
36283764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University