View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15730_low_1 (Length: 255)
Name: NF15730_low_1
Description: NF15730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15730_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 15871744 - 15871959
Alignment:
| Q |
18 |
gattcataccttacatggtcatggattcatcatcgcttcccgcgtaaggatataatttgtaggtaatctatgaatccttattctgagtttttatgcctgc |
117 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15871744 |
gattcatacctcacatggtcatggattcatcatcgcttcccgcgtaaggatataatttgtaggtaatctatgaatgtttattctgagtttttatgcctgt |
15871843 |
T |
 |
| Q |
118 |
ctagatgaacctccaggaccaaactcgcaaaaacnnnnnnnncttagaaaaagagcgtaagaaagtaatctttaattaagtgcctcttttgagctttgac |
217 |
Q |
| |
|
| ||||| ||||||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
15871844 |
c-cgatgagcctccaggaccaaactcgcaaaaac-tttttttcttaaaaaaagagcataagaaagtaatctttaatcaagtacctcttttgagctttgat |
15871941 |
T |
 |
| Q |
218 |
gtttgtcttaactagcct |
235 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
15871942 |
gtttgtcttagctagcct |
15871959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University