View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15730_low_2 (Length: 252)
Name: NF15730_low_2
Description: NF15730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15730_low_2 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 14 - 252
Target Start/End: Complemental strand, 5056770 - 5056529
Alignment:
| Q |
14 |
acagacggacagatttgtgatggcgccgccgatcaaggaaccttcttttggtatcactccatccacatcattcattcatctttcgtatcattatatattc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5056770 |
acagacggacagatttgtgatggcgccgccgatcaaggaaccttcttttggtatcactccatccatatcattcattcatctttcgtatcattatatattc |
5056671 |
T |
|
| Q |
114 |
ataa---ttgaaatcagtttttaatacttataatcatctcaatttttcattttatccaatgcttgcttttcgtccttcataagggtctacaagtatatag |
210 |
Q |
| |
|
|||| |||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5056670 |
ataaatattgaaatccctttttaattcttataatcatctcaatttttcattttatccaatgcttgcttttcgtccttcataagggtctacaagtatgtag |
5056571 |
T |
|
| Q |
211 |
ttttgtgatttacaaaactaaaatgtgggtaaaaaatatata |
252 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5056570 |
ttttgtgatttacaagactaaaatgtgggtaaaaaatatata |
5056529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University