View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15731_high_13 (Length: 241)
Name: NF15731_high_13
Description: NF15731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15731_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 9 - 144
Target Start/End: Original strand, 43289228 - 43289359
Alignment:
| Q |
9 |
gaaatgaatgaggaagaagacacaagtaattaaactcaaagatgcaataaacaagacagatagataataaacacgatagagacaagaaatgtatttagcc |
108 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43289228 |
gaaatggatgaggaagaagacacaggtaattaaactcaaagatgcaataaacaagacagat----aataaacacgatagagacaagaaatgtatttagcc |
43289323 |
T |
 |
| Q |
109 |
cttgaagtgaaaaaattgctaaaggaccctcacaca |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
43289324 |
cttgaagtgaaaaaattgctaaaggaccctcacaca |
43289359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University