View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15731_high_14 (Length: 237)
Name: NF15731_high_14
Description: NF15731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15731_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 172
Target Start/End: Original strand, 10418853 - 10419007
Alignment:
| Q |
18 |
gtttactagagcaactcaactctctagctaaccatgattaacaacctaactatagttagcagttataactaactgttaaaacagttgcaatagctctgag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10418853 |
gtttactagagcaactcaactctctagctaaccatgattaacaacctaactatacttagcagttataactaactgttaaaacagttgcaatagctatgag |
10418952 |
T |
 |
| Q |
118 |
ataaccaattactagttatgcaaacaatttcttcttccattcacggagataattg |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10418953 |
ataaccaattactagttatgcaaacaatttcttcttccattcacggagataattg |
10419007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 25 - 74
Target Start/End: Complemental strand, 35369486 - 35369437
Alignment:
| Q |
25 |
agagcaactcaactctctagctaaccatgattaacaacctaactatagtt |
74 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
35369486 |
agagcaactcaactatctaactaaccatgattaacaacctaactatagtt |
35369437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 91
Target Start/End: Complemental strand, 20069783 - 20069715
Alignment:
| Q |
24 |
tagagcaactcaactctctagct-aaccatgattaacaacctaactatagttagcagttataactaact |
91 |
Q |
| |
|
||||| |||||||||||||| | ||| ||||||||| |||||||||| |||||||| |||||| |||| |
|
|
| T |
20069783 |
tagagaaactcaactctctaattaaactatgattaactacctaactatggttagcagctataacaaact |
20069715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 84 - 140
Target Start/End: Original strand, 7021300 - 7021356
Alignment:
| Q |
84 |
aactaactgttaaaacagttgcaatagctctgagataaccaattactagttatgcaa |
140 |
Q |
| |
|
||||||||||||| |||||| || ||||| || |||||||| ||||| ||||||||| |
|
|
| T |
7021300 |
aactaactgttaagacagttacagtagctatgtgataaccatttacttgttatgcaa |
7021356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University