View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15731_high_7 (Length: 339)
Name: NF15731_high_7
Description: NF15731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15731_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 18 - 330
Target Start/End: Original strand, 9499733 - 9500044
Alignment:
| Q |
18 |
ccacctatggtgtcctatcatttttgtggatcccccactcctctaagggtttgaaccaaagcctctcccatcaccaacccccactttttatgaaggcctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9499733 |
ccacctatggtgtcctatcatttttgtggatcccccactcctctaagggtttgaaccaaagcctctcccatcaccaacccccactttttatgaaggcctt |
9499832 |
T |
|
| Q |
118 |
attccactccaccatttgttgcctactttcaatttctgtacatggtttgttattgtctgctagaatattatggcgtcgtttgatccacttagtgggataa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9499833 |
attccactccaccatttgttgcctactttcaatttctgtacatggtctgttattgtctgctagaatattatggcgtcgtttgatccactcagtgggataa |
9499932 |
T |
|
| Q |
218 |
ggctaggttgttgtttattactgtttgctgaccgttctggtatgttgctggccatccctcccactgttcttttttcacatgtcagtgagctttgttctgt |
317 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9499933 |
ggctaggttgttgtttattactgtctgctgaccgttctggtatgttgctggccatccctcccactgttcttttttcacatgtcagtgagctttgttctg- |
9500031 |
T |
|
| Q |
318 |
ttttgcataactt |
330 |
Q |
| |
|
||||||||||||| |
|
|
| T |
9500032 |
ttttgcataactt |
9500044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University