View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15731_high_9 (Length: 306)
Name: NF15731_high_9
Description: NF15731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15731_high_9 |
 |  |
|
| [»] scaffold0094 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 229
Target Start/End: Complemental strand, 51768694 - 51768481
Alignment:
| Q |
16 |
ggacaaaggtgactactaatatgtaatggtgcttattttagttagcatatgtgtctgctgtataaagttatcaaatttacttataatctagctctaagaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51768694 |
ggacaaaggtgactactaatatgtaatggtgcttattttagttagcatatgtgtctgctgtataaagttatcaaatttacttataatctagctctaagaa |
51768595 |
T |
 |
| Q |
116 |
cacctctataaacctagtggggtaggagcattctgccggatatccttttggattgactaagaagtcttatttactgtgagccgcaccgtgttttaaccga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51768594 |
cacctctataaacctagtggggtaggagcattctgccggatatccttttggattgactaagaagtcttatttactgtgagccgcaccgtgttttaaccga |
51768495 |
T |
 |
| Q |
216 |
aaaagcttcttgag |
229 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
51768494 |
aaaaccttcttgag |
51768481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 235 - 284
Target Start/End: Complemental strand, 51768446 - 51768397
Alignment:
| Q |
235 |
ttttttctttgatttacatttcaaatagttctgtggattttaatcaatat |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51768446 |
ttttttctttgatttacatttcaaatagttctgtggattttaatcaatat |
51768397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0094 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0094
Description:
Target: scaffold0094; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 132 - 185
Target Start/End: Original strand, 42207 - 42260
Alignment:
| Q |
132 |
gtggggtaggagcattctgccggatatccttttggattgactaagaagtcttat |
185 |
Q |
| |
|
|||||||||||||||||||| || ||| |||||| ||||| |||||||||||| |
|
|
| T |
42207 |
gtggggtaggagcattctgctggcaatctttttggcttgaccaagaagtcttat |
42260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University