View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15731_low_10 (Length: 279)
Name: NF15731_low_10
Description: NF15731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15731_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 4 - 262
Target Start/End: Complemental strand, 40660089 - 40659828
Alignment:
| Q |
4 |
ggttgatgaatgttgatcctgatcctagcaacaagctagctagcttactttgaaggtgctggtgattaggaactaa---ggtcttagaccttctcaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40660089 |
ggttgatgaatgttgatcctgatcctagtaacaagctagctagcttactttgaaggtgctggtgattaggaactaataaggtcttagaccttctcaataa |
40659990 |
T |
|
| Q |
101 |
caaggatgccatattctattcagtcacaatttcacagggaaatgaaaatgctataatagaaaaatttatgatgggaaaaggacaatttctagtagtcagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40659989 |
caaggatgccatattctattcagtcaaaatttcacagggaaatgaaaatgctataatagaaaaatttatgatgggaaaaggacaaattctagtagtcagc |
40659890 |
T |
|
| Q |
201 |
cattattttcttcttatcttagtacgttgtctcttgtctcgacagcaaagacgtggaaagct |
262 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40659889 |
cattattttcttcttatctgagtacgttgtctcttgtctcgacagcaaagacgtggagagct |
40659828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University