View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15731_low_8 (Length: 309)
Name: NF15731_low_8
Description: NF15731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15731_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 18 - 299
Target Start/End: Original strand, 47933812 - 47934093
Alignment:
| Q |
18 |
attggattcttctattttgccttctaattaaccatttgttgcccttctagaacatcggttgagggtttcgtcattgttagtgctactacctcgccattac |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47933812 |
attggattcttctcttttgccttctaattaaccatttgttgcccttctagaacatcggttgagggtttcgtcattgttagtgctactacctcgccaatac |
47933911 |
T |
 |
| Q |
118 |
ccctgacagttattttcgaatataccagttttgatgcaatggtaaagttgctgtcacgtaactaaaagggtatttaggtcttgagaacaccctctggtgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
47933912 |
ccctgacagttattttcgaatataccagctttgatgcaatggtaaagttgttgtcacgtaactaaaaaggtatttaagtcttgagaacaccctctggtgt |
47934011 |
T |
 |
| Q |
218 |
aaacaacacggaagcagcgcacaatataccaattgattggacccccttcctagaacggctcatttactagaacggctctctg |
299 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47934012 |
aaacatcacggaagcagcgcacaatataccaattgattggacccccttcctagaacggctcatttactagaatggctctctg |
47934093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University