View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15732_low_15 (Length: 238)
Name: NF15732_low_15
Description: NF15732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15732_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 1391246 - 1391452
Alignment:
| Q |
15 |
cagagatcatttgccgatttgtacaatttagagactatttggaccgttgtttacaattttgaggaacatattcttaatcactcgacaacatatttatttg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1391246 |
cagagatcatttgccgatttgtacaatttagagactatttggaccgttgtttacaattttgaagaacatattcttaatcactcgacaacatatttatttg |
1391345 |
T |
 |
| Q |
115 |
cagacctagcaaagctgcaaatgtaactaaacacaaattagagtccagtatagcctttttgttttagacatttattcacatttctttatgtaattttcaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1391346 |
cagacctagcaaagctgcaaatgtaactaaacacaaattagagtccagtatagcctttttgttttagacatttattcacttttctttatgtaattttcaa |
1391445 |
T |
 |
| Q |
215 |
atcatat |
221 |
Q |
| |
|
||||||| |
|
|
| T |
1391446 |
atcatat |
1391452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University