View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15733_low_13 (Length: 299)
Name: NF15733_low_13
Description: NF15733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15733_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 102 - 274
Target Start/End: Complemental strand, 18960954 - 18960781
Alignment:
| Q |
102 |
taaacatatgtgattgataaattctgaatgatcttttccttttagagttatgtccacttgacacttcactttttgtatgtatacctcatgaatcgtcgtg |
201 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| ||||| | |||||||| |
|
|
| T |
18960954 |
taaacatatgtgattgataaattcagaatgatcttttccttttagagttatgtccacttgacacttgattttttgtatgtatatctcattagtcgtcgtg |
18960855 |
T |
 |
| Q |
202 |
acacttggttttttacacggataatac-tttgttcgttttatggattcctcttaacacttggcttgttgtatgg |
274 |
Q |
| |
|
|||||||||||||||||||||||| || |||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18960854 |
acacttggttttttacacggataacacttttgtttgtttcatggattcctcttaacacttggcttgttgtatgg |
18960781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 18961056 - 18961023
Alignment:
| Q |
1 |
attataattgacttctctaccaatgatatcaatc |
34 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
18961056 |
attataattgacttctctaccaatgctatcaatc |
18961023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 241 - 273
Target Start/End: Complemental strand, 31860868 - 31860836
Alignment:
| Q |
241 |
atggattcctcttaacacttggcttgttgtatg |
273 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
31860868 |
atggattcctcttaacatttggcttgttgtatg |
31860836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University