View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15733_low_4 (Length: 451)
Name: NF15733_low_4
Description: NF15733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15733_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 234
Target Start/End: Original strand, 5438654 - 5438868
Alignment:
| Q |
17 |
aaaacctaacctaaaaaactaatttttagcttttggggatttagaaaaattacctccaacaccagccaaaagcacaggaaaaacgaacttgtagcgctta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
5438654 |
aaaacctaacctaaaaaactaatttttagcttttggggatttagaaaaattacctccaacaccagccaaaagcacaggaaaaaagaacttgtagtgctta |
5438753 |
T |
|
| Q |
117 |
ataaagggttccttaggtagcggcggcggaggaggaggagccgtttgtgcccccatcgacgacggcgaagagaattcgttcgatttctgcccttgaaatt |
216 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5438754 |
ataaagggttccttaggtagcggcggc---ggaggaggagccgtttgtgcccccatcgacgactgcgaagagaactcgttcgatttctgcccttgaaatt |
5438850 |
T |
|
| Q |
217 |
gcttcagttgcgctgtta |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
5438851 |
gcttcagttgcgctgtta |
5438868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 116; E-Value: 8e-59
Query Start/End: Original strand, 307 - 441
Target Start/End: Original strand, 5438940 - 5439075
Alignment:
| Q |
307 |
tacatattttgggtttgtgattataaagctttggagaagaaccgtgatcagcaccaccttcactcattcttttattcacttttaccctaactctgatcac |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5438940 |
tacatattttgggtttgtgattataaagctttggagaagaaccgtgatcagcaccaccttcactcattcttttattcacttttaccctaactcagatcac |
5439039 |
T |
|
| Q |
407 |
actctacttgtcttgc-atgcaaccaaactcctttg |
441 |
Q |
| |
|
|||||||||||||||| || ||||||||||| |||| |
|
|
| T |
5439040 |
actctacttgtcttgcaatacaaccaaactcttttg |
5439075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 17 - 234
Target Start/End: Original strand, 5432155 - 5432384
Alignment:
| Q |
17 |
aaaacctaacctaaaaaactaatttttagcttttggggatttagaaaaattacctccaacacca---------gccaaaagcacaggaaaaacgaacttg |
107 |
Q |
| |
|
||||| ||||| ||||| | |||||||||||||| ||| | |||||||||||||||||| |||| ||||| |||| ||| ||||||||||| |
|
|
| T |
5432155 |
aaaacttaaccgaaaaatcgaatttttagctttttgggttgtagaaaaattacctccaataccaaaattgacagccaatagcataggccaaacgaacttg |
5432254 |
T |
|
| Q |
108 |
tagcgcttaataaagggttccttaggtagcggcggcggaggaggaggagccgtttgtgcccccatcgacgacggcgaagagaattcgttcgatttc---t |
204 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| || ||||||||||||||||| | |||||| |||| ||||||||||||||||||||||||| | |
|
|
| T |
5432255 |
tagcgcttaatgaagggttccttaggcagcggcggaggtggaggaggagccgtttgagtccccattgacggcggcgaagagaattcgttcgatttctgtt |
5432354 |
T |
|
| Q |
205 |
gcccttgaaattgcttcagttgcgctgtta |
234 |
Q |
| |
|
| ||| ||||||||||||| |||||||||| |
|
|
| T |
5432355 |
ggcctcgaaattgcttcagctgcgctgtta |
5432384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 396
Target Start/End: Original strand, 5432463 - 5432558
Alignment:
| Q |
307 |
tacatattttgggtttgtgattataaagctttggagaagaaccgtgatcagcac------caccttcactcattcttttattcacttttaccctaa |
396 |
Q |
| |
|
||||| ||||||||||||||||||| || |||||||||||| | |||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5432463 |
tacattttttgggtttgtgattatatagttttggagaagaagcatgatcagcactaccaccaccttcactcattcttttcttcacttttaccctaa |
5432558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University